Journal: Cell reports

Article Title: Upregulation of exosome secretion from tumor-associated macrophages plays a key role in the suppression of anti-tumor immunity.

doi: 10.1016/j.celrep.2023.113224

Figure Lengend Snippet: Figure 7. Targeting Rab27a by siRNA-loaded LNPs sensitized tumors to anti-PD-1 antibody (A) Heatmap showing scaled expression values of RAB27A, RAB27B, MADD, HGS, PDCD6IP, and TSG101 in four clusters of cells, including B cells (BCs), plasma cells (PCs), monocytes/macrophages (TAM), and dendritic cells (DCs).

Article Snippet: Murine TNF-a: 50-GGTGCCTATGTCTCAGCCTCTT-30 and 50-GCCATAGAA CTGA TGAGAGGGAG-3’; Murine IL-1b: 50- TGGACCTTCCAGGATGAGGACA-3’; Murine IL-6: 50-T ACCACTTCACAAGTCG GAGGC-30 and 50- CTGCAAGTGCATCA TCGTTG TTC-3’; TGF-b: 50-TGATACGCCTGAGTGGCTGTCT-3’; GAPDH: 50-CATCACT GCCACC CAGAAGACTG-30 and 50-ATGCCAGTGAGCTTCCCGTTCAG-3’. shRNA knockdown and CRISPR-Cas9 knockout shRNAs against human RAB27A (NM_004850, GCTGCCAATGGGACAAACATA, CAGGAGAGGTTTCGTAGCTA),96 mouse RAB27A (NM_001301230.1, CGAAACTGGATAA GCCAGCTA, GACAAACATAAGCCACGCGAT), human MADD (NG_029462.1, CCACAAGT ACAAGACGCCAAT, CCTGAAAGTATTTGGGCTAAA), mouse MADD (NM_001177720.1, CCACAAGTACAAGACGCCAAT, CCGCTCATTTATGGCAATGAT) or scrambled shRNA (Addgene, Catalog Number:1864) were co-transfected with viral packaging plasmids to package lentiviral particles using HEK293T cells.

Techniques: Expressing, Clinical Proteomics

Journal: Cell Cycle

Article Title: Suppression of the grainyhead transcription factor 2 gene (GRHL2) inhibits the proliferation, migration, invasion and mediates cell cycle arrest of ovarian cancer cells

doi: 10.1080/15384101.2017.1295181

Figure Lengend Snippet: Analysis of GRHL2 expression in serous EOC tumors by IHC. A. Representative IHC images of GRHL2 protein expression in normal ovarian tissues, low-malignant potential (LMP) tumors and high-grade (HG) tumors. B. Box-plot presentation of GRHL2 protein expression levels in normal ovarian tissues, LMP tumors and HG tumors. C. Western-blot analysis of endogenous GRHL2 protein expression in different EOC cell lines.

Article Snippet: CRISPR/Cas9 mediated GRHL2 knockout in A2780s cells CRISPR/Cas9 mediated GRHL2 knockout in A2780s cells was done according to the manufacturer's guidelines (Santa Cruz Biotechnology, Inc.), as described previously.

Techniques: Expressing, Western Blot

Journal: Cell Cycle

Article Title: Suppression of the grainyhead transcription factor 2 gene (GRHL2) inhibits the proliferation, migration, invasion and mediates cell cycle arrest of ovarian cancer cells

doi: 10.1080/15384101.2017.1295181

Figure Lengend Snippet: Analyses of alterations in functional phenotypes upon CRISPR/Cas9-mediated GRHL2 knockout (KO) in A2780s cells. (A) effect of GRHL2 KO on cell proliferation. (B, C) Representative images from one of the 3 independent experiments showing migration (B, left) and invasion (C, left) in the control clone and GRHL2-KO clones A1 and A2 (at magnification ×400). The bar graphs in panels B (right) and C (right) are quantitative determinations of data obtained by selecting 10 random fields per filter (at magnification× 40) under phase contrast microscopy. Differences between control cells and KO cells were determined by a Student's t-test. Error bars denote ± SEM and *indicates statistical significance (p ≤ 0.05).

Article Snippet: CRISPR/Cas9 mediated GRHL2 knockout in A2780s cells CRISPR/Cas9 mediated GRHL2 knockout in A2780s cells was done according to the manufacturer's guidelines (Santa Cruz Biotechnology, Inc.), as described previously.

Techniques: Functional Assay, CRISPR, Knock-Out, Migration, Control, Clone Assay, Microscopy

Journal: Cell Cycle

Article Title: Suppression of the grainyhead transcription factor 2 gene (GRHL2) inhibits the proliferation, migration, invasion and mediates cell cycle arrest of ovarian cancer cells

doi: 10.1080/15384101.2017.1295181

Figure Lengend Snippet: Effect of GRHL2 suppression on cell cycle control in EOC cells. (A) Effect of GRHL2 suppression on cell cycle control in A2780s cells. Cell-cycle profile was examined by flow cytometry and percentages of cells in G0/G1, S, and G2/M phase in the GRHL2 KO clone A1 were compared with the mock-transfected control (Ctrl) clone. Propidium iodide staining shows an increased fraction of cells in the G1-phase and a decrease of cells in the S-phase at 0 h, and especially at 6 and 12 h post hydroxyurea removal in the A1 clone, when compared with the control clone (Ctrl). (B) Effect of GRHL2 suppression on cell cycle control in SKOV3 cells. Cell-cycle profiles were examined by flow cytometry and percentages of cells in G0/G1, S, and G2/M phase in the shRNA-GRHL2 clone 2 (sh-S2) were compared with the mock-transfected control (Ctrl) clone. Propidium iodide staining shows a significantly increased fraction of cells in the G1-phase and a strong decrease of cells in the S-phase at 0, 6 and 12 h post hydroxyurea removal in the sh-S2 clone, when compared with the control clone (Ctrl).

Article Snippet: CRISPR/Cas9 mediated GRHL2 knockout in A2780s cells CRISPR/Cas9 mediated GRHL2 knockout in A2780s cells was done according to the manufacturer's guidelines (Santa Cruz Biotechnology, Inc.), as described previously.

Techniques: Control, Flow Cytometry, Transfection, Staining, shRNA

Journal: Cell Cycle

Article Title: Suppression of the grainyhead transcription factor 2 gene (GRHL2) inhibits the proliferation, migration, invasion and mediates cell cycle arrest of ovarian cancer cells

doi: 10.1080/15384101.2017.1295181

Figure Lengend Snippet: Analyses of alterations in functional phenotypes upon shRNA-mediated GRHL2 knockdown (KD) in SKOV3 cells. (A) Effect of GRHL2 KD clones on cell proliferation compared with the control clone (B, C) Representative images from one of the 3 independent experiments showing migration (B, left) and invasion (C, left) in the control clone and GRHL2-knockdown clones sh-S2 and sh-S5 (at magnification ×400). The bar graphs in panels B (right) and C (right) are quantitative determinations of data obtained by selecting 10 random fields per filter (at magnification× 40) under phase contrast microscopy. Differences between control cells and KD cells were determined by a Student's t-test. Error bars denote ± SEM and *indicates statistical significance (p ≤ 0.05).

Article Snippet: CRISPR/Cas9 mediated GRHL2 knockout in A2780s cells CRISPR/Cas9 mediated GRHL2 knockout in A2780s cells was done according to the manufacturer's guidelines (Santa Cruz Biotechnology, Inc.), as described previously.

Techniques: Functional Assay, shRNA, Knockdown, Clone Assay, Control, Migration, Microscopy

Journal: Cell Cycle

Article Title: Suppression of the grainyhead transcription factor 2 gene (GRHL2) inhibits the proliferation, migration, invasion and mediates cell cycle arrest of ovarian cancer cells

doi: 10.1080/15384101.2017.1295181

Figure Lengend Snippet: Top canonical pathways that were significantly dysregulated upon GRHL2 knockout (KO) in A2780s cells. A. Canonical pathways associated with upregulated genes upon GRHL2 KO; B. Canonical pathways associated with downregulated genes upon GRHL2 KO. Top functions are displayed that meet the Benjamini-Hochberg (B-H) multiple testing correction p-value of 0.05.

Article Snippet: CRISPR/Cas9 mediated GRHL2 knockout in A2780s cells CRISPR/Cas9 mediated GRHL2 knockout in A2780s cells was done according to the manufacturer's guidelines (Santa Cruz Biotechnology, Inc.), as described previously.

Techniques: Knock-Out

Journal: Cell Cycle

Article Title: Suppression of the grainyhead transcription factor 2 gene (GRHL2) inhibits the proliferation, migration, invasion and mediates cell cycle arrest of ovarian cancer cells

doi: 10.1080/15384101.2017.1295181

Figure Lengend Snippet: Top canonical pathways that were significantly dysregulated upon GRHL2 knockdown (KD) in SKOV3 cells. A. Canonical pathways associated with upregulated genes upon GRHL2 KD; B. Canonical pathways associated with downregulated genes upon GRHL2 KD. Top functions are displayed that meet the B-H multiple testing correction p-value of 0.05.

Article Snippet: CRISPR/Cas9 mediated GRHL2 knockout in A2780s cells CRISPR/Cas9 mediated GRHL2 knockout in A2780s cells was done according to the manufacturer's guidelines (Santa Cruz Biotechnology, Inc.), as described previously.

Techniques: Knockdown

Journal: Cell Cycle

Article Title: Suppression of the grainyhead transcription factor 2 gene (GRHL2) inhibits the proliferation, migration, invasion and mediates cell cycle arrest of ovarian cancer cells

doi: 10.1080/15384101.2017.1295181

Figure Lengend Snippet: Top canonical pathways that were significantly dysregulated upon GRHL2 overexpression in SKOV3 cells. A. Canonical pathways associated with upregulated genes upon GRHL2 overexpression; B. Canonical pathways associated with downregulated genes upon GRHL2 overexpression. Top functions are displayed that meet the B-H multiple testing correction p-value of 0.05.

Article Snippet: CRISPR/Cas9 mediated GRHL2 knockout in A2780s cells CRISPR/Cas9 mediated GRHL2 knockout in A2780s cells was done according to the manufacturer's guidelines (Santa Cruz Biotechnology, Inc.), as described previously.

Techniques: Over Expression